1、Conservation Genetics,ECOL 3530 Fall 2009,We will talk about genetics from two perspectives.First, we will talk about how genetics influences the viability of populations, both now and in the sense of adaptation to future change.Second, we will talk about how genetic tools provide new insight into c
2、onservation problems.,Some current issues,What to count?,Nc= number of individuals Or Ne= genetically effective population,Genetically effective population,The genetically effective population (N with subscript e, Ne) is the number of individuals in a population that contribute genes to the next gen
3、eration.It is usually less, and often much less, than the census population (Nc).,From a genetics perspective,Populations are smaller than they seem Genetic diversity is lost as Ne declines, not just Nc Ne reduced by many things, e.g., unequal sex ratio, mating structure, population fragmentation, a
4、ge-related disease (Ebola), etc. etc.,Know WHAT to countgenetic effective population size Ne,It is influenced by age structure, sex ratio, social structure, and especially by spatial structure. Metapopulation structure may enhance population viability but it may also contribute to loss of genetic va
5、riation by reducing Ne. Genetic models typically use Ne rather than Nc.Loss in heterozygosity depends on Ne not Nc,First, a conservation crisis and a genetics enigma,All the remaining individuals of the Great and Lesser Apes would fit into a couple of football stadiums (IUCN Red Book 2007) Ebola vir
6、us in Africa (made worse by war, habitat loss (logging and oil palm), bushmeat, poaching, etc.) Ne =?,The enigma of viruses,Cause of many diseases that threaten species (plants and animals). Total number of viral types is huge. Viruses, especially single strand RNA viruses, have very high mutation r
7、ates. Viruses are obviously successful yet many have as few as five genes. Ebola has only 15 genes.,Viral enigma,With high mutation rates and few genes how do they adapt to host immune defenses?,ANDeffects of genetic change on ecosystems,A species pool of genetic diversity exists at three fundamenta
8、l levels,Evolutionary Change,Mutation,Genetic drift,Migration/gene flow,Natural selection,Most mutations are recessive. Here the mutation is dominant,Hairy-Nosed Wombat. Is 65 enough to survive?,300 Right Whales?,1000 Kemps Ridley Turtle?,If these populations can increase, are these numbers good ins
9、urance against extinction? Must also consider genetic variation.,What can genetics tell us?,Slower recovery of genetic variation,Genes lost through drift,More homozygosity,Population bottlenecks and reduced genetic variation,Lost uncommon black allele,Rare alleles more likely lost in small populatio
10、ns (genetic drift),Galapagos tortoise population on Volcan alcedo suffered severe bottleneck about time of massive eruption (molecular clock and geological evidence). Population has less genetic variation than other populations but population has recovered.,American bison, a bottleneck enigma?At tim
11、e of European contact, bison estimate was about 60,000,000 By 1890 it was about 750 By 2000 the number was about 360,000Bison have considerable genetic variation (within and between population heterozygosity).How did they retain so much genetic variation?Hint: geographic herds and buffalo parks.,Som
12、e, but not all, inbred populations have lower fitness due to expression of deleterious genes,Deleterious genes are usually recessive. So in more homozygous inbred populations they are more likely to occur at the same locus.,Inbred white-footed mice (open circles) had lower survivorship than outbred
13、individuals (solid circles) after release into the wild,Population of 40 European Adders was isolated by road. In a few years malformed individuals and lower birth rates began to cause population decline. This is an example of inbreeding depression. Population growth was restored when individuals fr
14、om different population were introduced.,Inbreeding depression Vulnerable small populations,Not all alleles are equal,MHC (major histocompatibility complex) genes enhance immune response. Located on chromosome 6 in humans.Heterozygous MHC generates more types of immune molecules and therefore is mor
15、e “adaptive” to counter diverse pathogens.,Intracellular diversity of MHC is important,MHC codes for large proteins that transport viral particles to surface and holds them for T-cells (killer cells) Viral diversity is best delt with by diversity of MHC proteins Trade-off is that large proteins are
16、costly to make. Therefore?,Animals, including humans, that are under chronic stress are often unable to mobilize an effective immune response to a pathogen,African Cheetahs, wild and in zoos, are highly inbred with little genetic variation. A feline viral disease swept through European zoos killing
17、many cheetahs. Lions have much greater genetic variation and were relatively unaffected by the disease.,How some plants avoid inbreeding, Programmed cell death; an auto-immune response of style (obligate outcrossing). Timing of stigma and style reception differ Male and female flowers on different p
18、lants Foreign pollen out-competes self pollen (common),Many domesticated plants and animals, especially pets, are highly inbred,and some people. Why states outlaw marriage between close relatives.,Charles II of Spain illustrates the Hapsburg lip, an Inbred trait in this royal line.,Severe effects of
19、 inbreeding in zoo tiger,Bottleneck consequences,More deleterious genes expressed by more homozygosity means very slow recovery or extinction(African Cheetah) Fewer deleterious genes means fast recovery (N. Elephant Seal) Recovery from bottleneck may reduce future inbreeding effects. Founder effect
20、from migrants from small population,Genetics as a tool for conservation management,Genetics provides new insight,Pacific Gray Whales thought to be recovery success at 22,000 current Nc But, 10% whales are undernourished Calving frequency is down Feeding behavior has shifted from “bottom plowing” (wh
21、ich supports sea birds) to feeding in water column,Pacific Gray Whale: Using Genetics to Infer the Past,Gray whales migrate from winter feeding area to southern mating and breeding site. Longest mammal migration.,Pit marks left by whale foraging. Currently re-suspend about 172 million tons each year
22、. More than 2X that produced by the Yukon River, the 3rd largest US river. Nutrients support fish and food for sea birds.,Recovery to 22,000. A success story?,Gray whale cont,Genetic variation between individuals indicates much larger population in past(mismatch analysis of sequence frequencies) Acc
23、ounts from 1700s indicates large whale populations. Their “fetid breath fouled Monterey Bay” Calif. Bishop,Gray whale cont,Decline in plankton, plankton-feeding fish and the birds that eat those fish suggests a decline in productivity Probably related to global warming and temperature increase in co
24、astal waters Thus, Gray Whales may not be at historic carrying capacity but rather the environment is changing to their detriment.,Gray whale cont,Genetic information suggests an early population between 78,500-117,000 These populations would have disturbed between 22-31% of the sea sediment each ye
25、ar and the effect from this nutrient input on birds and fish?,Grizzly bears: what genetic tools can tell us,The size of the population The sex ratio Migration Done through the use of microsatellite markers.,Grizzly bear range in lower 48 states,ACTAGACACACACACACACTAGCGACCTACTACTACTAG,Individual one:
26、 Two microsatellites. 7AC and 3ACT,Microsatellite is a repetitive sequence of 1-6 base pairs on single strand of DNA,ACTAGACACACACACACTAGCGACCTACTACTACTAG,Individual two: Two microsatellites. 6AC and 3ACT,In practice, many microsatellites are needed to create individual genetic fingerprints, i.e. to
27、 identify individuals. But fewer needed to identify species or geographic populations.,Heterozygosity loss in 100 grizzly bears,Exchange 2 unrelated bears every 10 years in 100 Nc bearsIsolated 100 Nc bears,Genetics and dams.Populations of Oncorhynchus mykiss usually contain two forms, a freshwater
28、form called Rainbow Trout and a form the lives mostly in the sea, returning to freshwater to spawn, Steelhead Trout. Putting a “Steelhead ladder” around a dam in California allowed Steelheads to mate with Rainbows, thereby increasing genetic diversity.,Genetics can help make conservation decisions.W
29、hich river basin should be preserved? Each has four imperiled fish species.,A genetic analysis shows that fish in river basin C have fewer genes in common (or morphological characters are very different). Protecting river basin C would protect the greatest genetic diversity. But, may be other consid
30、erations in choosing the river basin,Genetics and captive breeding. May select for individuals that are adapted to the captive environment but not to the wild environment, e.g., may not recognize predators. Difficult to avoid.,Canada geese in Chesapeake Bay carried E. coli resistant to penicillin G,
31、 ampicillin, cephalothin, and sulfathiazole; and enterococci resistant to cephalothin, streptomycin, and sulfathiazole.,Wildlife as possible vectors of antibiotic resistance genes?,What can you learn about populations from measuring levels of heterozygosity? First, you have to know what is “normal”
32、or average for the taxon.,Among population genetic diversity (Dpt) What can it tell you?Above average for taxon: Unusual spatial segregation; low mobility; high site fidelity (Red Cockaded Woodpeckers, Howler monkeys); farther from “ideal” breeding population Nc much Higher than NeBelow average for
33、taxon: Unusual high migration; panmixis; closer to “ideal” breeding population Nc close to Ne,Heterozygosity, Some genetically identical populations do well (Northern Elephant Seal) others not (Cheetahs) Rate of decline in heterozygosityis extremely important,Better insight into conservation problem
34、s by combining genetic with non-genetic tools,Swainson ThrushA neotropical migrant. Declining in some parts of its U.S. breeding range but not in others. Why?,Swainson Thrush breeds in northern North America from northern California and Great Lakes into Canada and Alaska. During the non-breeding sea
35、son it is somewhere in the southern US or down into Latin America as far as Argentina.,Combining genetic with other methodsFor migratory birds, how can we associate breeding sites with non-breeding sites? For Swainson thrush breeding in Wisconsin, where did they spend their non-breeding time?,Suppos
36、e the Wisconsin population began declining and you want to know what is happening to the thrushs habitat on its non-breeding habitat. Where would you begin to look? If you banded 100 birds in Wisconsin, what would be the probability of recovering them somewhere between Georgia and Argentina?,Genetic
37、sMitochondrial DNA (mtDNA) is extranuclear and therefore inherited maternally. Chloroplast DNA in plants is similar. mtDNA is not reorganized during recombination and remains stable within maternal lines, except for mutations.,mtDNA is haploid. Segments of DNA can be separated by restriction enzymes
38、 and sequenced for their gene array.Segments (microsatellites) that are associated with specific geographic areas are called haplotypes. For the thrush, there are tropical coastal haplotypes and interior haplotypes.Very small amounts of blood can be taken from feathers and the DNA amplified by PCA f
39、or analysis by sequencing.,coupled with non-genetic methodStable isotopes: Non-radioactive elements with more than the normal number of neutrons. Most stable isotopes have one or two extra neutrons and are therefore very slightly heavier, e.g., Carbon-12/13, Nitrogen-14/15, Oxygen-16/18, Deuterium -
40、1/2, and Sulfur-32/34,Hydrogen H/D: strong North-South gradient in ratio in precipitationSulfur: marine sulfur is enriched with heavy sulfur isotopeTherefore: H/D isotopes in feathers record the latitude of moltS/S isotopes in feathers tell if individual was from a coastal population,Pre-molting fea
41、thers were sampled for isotope ratios and mtDNA to provide evidence of where the female was when the feathers were formed the previous year. Non-invasive.Birds were banded.,Results By combining both isotope and mtDNA analysis, 75% of the birds could be assigned to their correct breeding and non-bree
42、ding sites.Reference: Kelly et al. 2005. Combining isotopic and genetic markers to identify breeding origins of migrant birds. Ecol. Appl. 15: 1487-1494.,Genetic markers to determine origins of protected populations,DNA amplified from fecal and tissue samples Used to construct DNA library to determine origin of elephant ivory, etc.,Genes and Ecosystems,Cottonwood trees (Populus spp.)Occurs along streamsSeveral species hybridize,Cottonwood + beavers,Cottonwood genotypes with high tannin conc,Fewer insects and less endophytic fungi,Fewer birds,=,=,and,
